DNA Sequence Analysis Exercise

(Prepared by Gail Baughman, MiraCosta College)


You can use the tools of the World Wide Web to search the GenBank DNA sequence database for similarities to an unknown DNA sequence. You can type in your own sequence with any word processor then cut and paste it into the web data base search engine or you can cut and paste from the examples given here.

 


You will begin your search by accessing the National Center for Biotechnology Information web site: http://www.ncbi.nlm.nih.gov. Use the back button in your browser to return to this page.

Under Database Services choose BLAST Sequence Similarity searching.

 

Sequence Samples:

Obtain the BLAST report on the following fragments of gene sequences and give the reported best fit:

1. CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGAC

2. AGGCCAAGATGGCGGCAGCTGCGGCTTCGCTTCGCGGGGTAGTGTTGGGCCCGCGGGGCGCGGGGCTCCCGGGCGCGCGTGCCCGGGGTCTGCTGTGCAGCGCGCGGCCCGGGCAGCTCCCGCTAC

3. ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACC

4. TAATTTGTAGGTCTCTCCACCAAATGAAAATGTTGCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAGATCTGGAAATGAAGATGAATTTAGA

5. ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCT


For additonal information and a great way to search for human genes visit Online Medelian Inheritance in Man (OMIN)